Review





Similar Products

90
Addgene inc lenticrispr v2 plasmid
Lenticrispr V2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lenticrispr v2 plasmid/product/Addgene inc
Average 90 stars, based on 1 article reviews
lenticrispr v2 plasmid - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Promega lenticrispr v2 plasmid
Lenticrispr V2 Plasmid, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lenticrispr v2 plasmid/product/Promega
Average 90 stars, based on 1 article reviews
lenticrispr v2 plasmid - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Addgene inc lenticrispr v2-btn3a ko grna-tngfr plasmid
Lenticrispr V2 Btn3a Ko Grna Tngfr Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lenticrispr v2-btn3a ko grna-tngfr plasmid/product/Addgene inc
Average 90 stars, based on 1 article reviews
lenticrispr v2-btn3a ko grna-tngfr plasmid - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Addgene inc lenticrispr v2-tngfr plasmid
Lenticrispr V2 Tngfr Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lenticrispr v2-tngfr plasmid/product/Addgene inc
Average 90 stars, based on 1 article reviews
lenticrispr v2-tngfr plasmid - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Addgene inc lenticrispr v2 containing cas9 and puromycin resistance marker plasmid
A. Scatter plot showing the Z-scored average log2 fold change (LFC) of gene knockout effects in Rh30 cells treated with BI-1347 versus DMSO at day 14 (y-axis) and day 21 (x-axis) from genome-wide <t>CRISPR-Cas9</t> screens. Each point represents an individual gene; dot size corresponds to statistical significance, and dot color indicates classification. B. Bubble dot plot of GSEA for gene hits scoring at day 21 in the CRISPR-Cas9 BI-1347 drug modifier screen ranked by C5 gene sets. C. Box plots showing construct-level Z-score averages for individual genes in the SAGA complex from the genome-wide CRISPR-Cas9 screen in Rh30 cells treated with DMSO (gray/black) or BI-1347 (blue/red) for 14 days (gray and blue) or 21 days (black and red). Genes are grouped by SAGA functional modules. D-F. Live cell proliferation assessed by Incucyte for BI-1347+/-sgTADA2B ( D ), BI-1347+/-sgTAF5L ( E ), and BI-1347+/-GSK699 ( F ). G. Quantitative real-time TaqMan qPCR analysis of RUNX1 , SEMA3D , and VGLL 2 expression at day 7 following treatment with vehicle control (DMSO), CDK8 inhibitors, or GSK699, and the indicated combination treatments. Expression levels were normalized to GAPDH gene expression and shown relative to DMSO control. Data represent means ± SEM (n=6).
Lenticrispr V2 Containing Cas9 And Puromycin Resistance Marker Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lenticrispr v2 containing cas9 and puromycin resistance marker plasmid/product/Addgene inc
Average 90 stars, based on 1 article reviews
lenticrispr v2 containing cas9 and puromycin resistance marker plasmid - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

94
Addgene inc plenticrispr cas9 v2 vector
A. Scatter plot showing the Z-scored average log2 fold change (LFC) of gene knockout effects in Rh30 cells treated with BI-1347 versus DMSO at day 14 (y-axis) and day 21 (x-axis) from genome-wide <t>CRISPR-Cas9</t> screens. Each point represents an individual gene; dot size corresponds to statistical significance, and dot color indicates classification. B. Bubble dot plot of GSEA for gene hits scoring at day 21 in the CRISPR-Cas9 BI-1347 drug modifier screen ranked by C5 gene sets. C. Box plots showing construct-level Z-score averages for individual genes in the SAGA complex from the genome-wide CRISPR-Cas9 screen in Rh30 cells treated with DMSO (gray/black) or BI-1347 (blue/red) for 14 days (gray and blue) or 21 days (black and red). Genes are grouped by SAGA functional modules. D-F. Live cell proliferation assessed by Incucyte for BI-1347+/-sgTADA2B ( D ), BI-1347+/-sgTAF5L ( E ), and BI-1347+/-GSK699 ( F ). G. Quantitative real-time TaqMan qPCR analysis of RUNX1 , SEMA3D , and VGLL 2 expression at day 7 following treatment with vehicle control (DMSO), CDK8 inhibitors, or GSK699, and the indicated combination treatments. Expression levels were normalized to GAPDH gene expression and shown relative to DMSO control. Data represent means ± SEM (n=6).
Plenticrispr Cas9 V2 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plenticrispr cas9 v2 vector/product/Addgene inc
Average 94 stars, based on 1 article reviews
plenticrispr cas9 v2 vector - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

96
Addgene inc lenticrispr v2 addgene
A. Scatter plot showing the Z-scored average log2 fold change (LFC) of gene knockout effects in Rh30 cells treated with BI-1347 versus DMSO at day 14 (y-axis) and day 21 (x-axis) from genome-wide <t>CRISPR-Cas9</t> screens. Each point represents an individual gene; dot size corresponds to statistical significance, and dot color indicates classification. B. Bubble dot plot of GSEA for gene hits scoring at day 21 in the CRISPR-Cas9 BI-1347 drug modifier screen ranked by C5 gene sets. C. Box plots showing construct-level Z-score averages for individual genes in the SAGA complex from the genome-wide CRISPR-Cas9 screen in Rh30 cells treated with DMSO (gray/black) or BI-1347 (blue/red) for 14 days (gray and blue) or 21 days (black and red). Genes are grouped by SAGA functional modules. D-F. Live cell proliferation assessed by Incucyte for BI-1347+/-sgTADA2B ( D ), BI-1347+/-sgTAF5L ( E ), and BI-1347+/-GSK699 ( F ). G. Quantitative real-time TaqMan qPCR analysis of RUNX1 , SEMA3D , and VGLL 2 expression at day 7 following treatment with vehicle control (DMSO), CDK8 inhibitors, or GSK699, and the indicated combination treatments. Expression levels were normalized to GAPDH gene expression and shown relative to DMSO control. Data represent means ± SEM (n=6).
Lenticrispr V2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lenticrispr v2 addgene/product/Addgene inc
Average 96 stars, based on 1 article reviews
lenticrispr v2 addgene - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

96
Addgene inc lenticrispr v2
A. Scatter plot showing the Z-scored average log2 fold change (LFC) of gene knockout effects in Rh30 cells treated with BI-1347 versus DMSO at day 14 (y-axis) and day 21 (x-axis) from genome-wide <t>CRISPR-Cas9</t> screens. Each point represents an individual gene; dot size corresponds to statistical significance, and dot color indicates classification. B. Bubble dot plot of GSEA for gene hits scoring at day 21 in the CRISPR-Cas9 BI-1347 drug modifier screen ranked by C5 gene sets. C. Box plots showing construct-level Z-score averages for individual genes in the SAGA complex from the genome-wide CRISPR-Cas9 screen in Rh30 cells treated with DMSO (gray/black) or BI-1347 (blue/red) for 14 days (gray and blue) or 21 days (black and red). Genes are grouped by SAGA functional modules. D-F. Live cell proliferation assessed by Incucyte for BI-1347+/-sgTADA2B ( D ), BI-1347+/-sgTAF5L ( E ), and BI-1347+/-GSK699 ( F ). G. Quantitative real-time TaqMan qPCR analysis of RUNX1 , SEMA3D , and VGLL 2 expression at day 7 following treatment with vehicle control (DMSO), CDK8 inhibitors, or GSK699, and the indicated combination treatments. Expression levels were normalized to GAPDH gene expression and shown relative to DMSO control. Data represent means ± SEM (n=6).
Lenticrispr V2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lenticrispr v2/product/Addgene inc
Average 96 stars, based on 1 article reviews
lenticrispr v2 - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

Image Search Results


A. Scatter plot showing the Z-scored average log2 fold change (LFC) of gene knockout effects in Rh30 cells treated with BI-1347 versus DMSO at day 14 (y-axis) and day 21 (x-axis) from genome-wide CRISPR-Cas9 screens. Each point represents an individual gene; dot size corresponds to statistical significance, and dot color indicates classification. B. Bubble dot plot of GSEA for gene hits scoring at day 21 in the CRISPR-Cas9 BI-1347 drug modifier screen ranked by C5 gene sets. C. Box plots showing construct-level Z-score averages for individual genes in the SAGA complex from the genome-wide CRISPR-Cas9 screen in Rh30 cells treated with DMSO (gray/black) or BI-1347 (blue/red) for 14 days (gray and blue) or 21 days (black and red). Genes are grouped by SAGA functional modules. D-F. Live cell proliferation assessed by Incucyte for BI-1347+/-sgTADA2B ( D ), BI-1347+/-sgTAF5L ( E ), and BI-1347+/-GSK699 ( F ). G. Quantitative real-time TaqMan qPCR analysis of RUNX1 , SEMA3D , and VGLL 2 expression at day 7 following treatment with vehicle control (DMSO), CDK8 inhibitors, or GSK699, and the indicated combination treatments. Expression levels were normalized to GAPDH gene expression and shown relative to DMSO control. Data represent means ± SEM (n=6).

Journal: bioRxiv

Article Title: CDK8 Inhibition Releases the Muscle Differentiation Block in Fusion-driven Alveolar Rhabdomyosarcoma

doi: 10.1101/2025.07.14.663986

Figure Lengend Snippet: A. Scatter plot showing the Z-scored average log2 fold change (LFC) of gene knockout effects in Rh30 cells treated with BI-1347 versus DMSO at day 14 (y-axis) and day 21 (x-axis) from genome-wide CRISPR-Cas9 screens. Each point represents an individual gene; dot size corresponds to statistical significance, and dot color indicates classification. B. Bubble dot plot of GSEA for gene hits scoring at day 21 in the CRISPR-Cas9 BI-1347 drug modifier screen ranked by C5 gene sets. C. Box plots showing construct-level Z-score averages for individual genes in the SAGA complex from the genome-wide CRISPR-Cas9 screen in Rh30 cells treated with DMSO (gray/black) or BI-1347 (blue/red) for 14 days (gray and blue) or 21 days (black and red). Genes are grouped by SAGA functional modules. D-F. Live cell proliferation assessed by Incucyte for BI-1347+/-sgTADA2B ( D ), BI-1347+/-sgTAF5L ( E ), and BI-1347+/-GSK699 ( F ). G. Quantitative real-time TaqMan qPCR analysis of RUNX1 , SEMA3D , and VGLL 2 expression at day 7 following treatment with vehicle control (DMSO), CDK8 inhibitors, or GSK699, and the indicated combination treatments. Expression levels were normalized to GAPDH gene expression and shown relative to DMSO control. Data represent means ± SEM (n=6).

Article Snippet: The sgRNA was cloned into lentiCRISPR v2 containing Cas9 and puromycin resistance marker plasmid (Addgene, plasmid#52961). sgChr2.2: GGTGTGCGTATGAAGCAGTG sgCDK8-3: GAGGACCTGTTTGAATACGA sgCDK8-4: AGTGACTTCACCATTCCCCG sgTADA2B-1: GACAGGTGTGGTCTGTCACG sgTADA2B-3: GGGCGGCTGGACCAGTCGCG sgTAF5L-1: AAACAGTCCGAAGAGCACAG sgTAF5L-3: GCAGAAACATTCCATGGAAG sgSIX4-1: GCCTGCCCAGAAGTTCCGAG sgSIX4-2: GGATCAGGTACAACTCCACT

Techniques: Gene Knockout, Genome Wide, CRISPR, Construct, Functional Assay, Expressing, Control, Gene Expression

A. Box plots showing construct-level Z-score averages for individual genes in the Mediator complex from a genome-wide CRISPR-Cas9 screen in Rh30 cells treated with DMSO (gray/black) or BI-1347 (blue/red) for 14 days (gray and blue) or 21 days (black and red). Genes are grouped by Mediator functional modules. B. Live cell proliferation assessed by Incucyte for BI-1347+/-sgCDK8 (red) and BI-1347+/-sgCCNC (blue). C. MA plot showing changes of CDK8 binding site assessed by CUT&RUN after 24 hrs of BI-1347 treatment. Significantly increased CDK8 peaks are highlighted in red; significantly decreased CDK8 peaks are highlighted in blue (padj<0.05, fold change>1.5 or <-1.5). D. Motif analysis of the regions with increased CDK8 DNA binding peaks from CUT&RUN analysis in Rh30 cells. E. Heatmaps showing chromatin occupancy of CDK8, CCNC, MED12, and MED13 at regions with upregulated SIX4 binding at 24 hrs of DMSO or BI-1347 treatment. F. IGV gene tracks showing the PRO-seq, CDK8, CCNC, MED12, and MED13 binding at the RUNX1 gene body and enhancer loci at indicated time points after BI-1347 treatment. G. Heatmaps of CDK8, CCNC, MED12, and MED13 CUT&RUN signal around PAX3::FOXO1-regulated enhancers before and after 24 hrs of BI-1347 treatment. H. IGV gene tracks showing the binding of CDK8, CCNC, MED12, and MED13 at a RUNX2 super enhancer cluster at indicated time points after BI-1347 treatment.

Journal: bioRxiv

Article Title: CDK8 Inhibition Releases the Muscle Differentiation Block in Fusion-driven Alveolar Rhabdomyosarcoma

doi: 10.1101/2025.07.14.663986

Figure Lengend Snippet: A. Box plots showing construct-level Z-score averages for individual genes in the Mediator complex from a genome-wide CRISPR-Cas9 screen in Rh30 cells treated with DMSO (gray/black) or BI-1347 (blue/red) for 14 days (gray and blue) or 21 days (black and red). Genes are grouped by Mediator functional modules. B. Live cell proliferation assessed by Incucyte for BI-1347+/-sgCDK8 (red) and BI-1347+/-sgCCNC (blue). C. MA plot showing changes of CDK8 binding site assessed by CUT&RUN after 24 hrs of BI-1347 treatment. Significantly increased CDK8 peaks are highlighted in red; significantly decreased CDK8 peaks are highlighted in blue (padj<0.05, fold change>1.5 or <-1.5). D. Motif analysis of the regions with increased CDK8 DNA binding peaks from CUT&RUN analysis in Rh30 cells. E. Heatmaps showing chromatin occupancy of CDK8, CCNC, MED12, and MED13 at regions with upregulated SIX4 binding at 24 hrs of DMSO or BI-1347 treatment. F. IGV gene tracks showing the PRO-seq, CDK8, CCNC, MED12, and MED13 binding at the RUNX1 gene body and enhancer loci at indicated time points after BI-1347 treatment. G. Heatmaps of CDK8, CCNC, MED12, and MED13 CUT&RUN signal around PAX3::FOXO1-regulated enhancers before and after 24 hrs of BI-1347 treatment. H. IGV gene tracks showing the binding of CDK8, CCNC, MED12, and MED13 at a RUNX2 super enhancer cluster at indicated time points after BI-1347 treatment.

Article Snippet: The sgRNA was cloned into lentiCRISPR v2 containing Cas9 and puromycin resistance marker plasmid (Addgene, plasmid#52961). sgChr2.2: GGTGTGCGTATGAAGCAGTG sgCDK8-3: GAGGACCTGTTTGAATACGA sgCDK8-4: AGTGACTTCACCATTCCCCG sgTADA2B-1: GACAGGTGTGGTCTGTCACG sgTADA2B-3: GGGCGGCTGGACCAGTCGCG sgTAF5L-1: AAACAGTCCGAAGAGCACAG sgTAF5L-3: GCAGAAACATTCCATGGAAG sgSIX4-1: GCCTGCCCAGAAGTTCCGAG sgSIX4-2: GGATCAGGTACAACTCCACT

Techniques: Construct, Genome Wide, CRISPR, Functional Assay, Binding Assay